Cardiac gene expression profile in rats with terminal heart failure and cachexia

Maren Wellner, Ralf Dechend, Joon-Keun Park, Erdenechimeg Shagdarsuren, Nidal Al-Saadi, Torsten Kirsch, Petra Gratze, Wolfgang Schneider, Silke Meiners, Anette Fiebeler, Hermann Haller, Friedrich C. Luft and Dominik N. Muller Physiol. Genomics 20:256-267, 2005. First published 28 December 2004; doi: 10.1152/physiolgenomics.00165.2004 You might find this additional info useful... This article cites 49 articles, 24 of which you can access for free at: http://physiolgenomics.physiology.org/content/20/3/256.full#ref-list-1

Updated information and services including high resolution figures, can be found at: http://physiolgenomics.physiology.org/content/20/3/256.full Additional material and information about Physiological Genomics can be found at: http://www.the-aps.org/publications/physiolgenomics This information is current as of February 23, 2013.

Physiological Genomics publishes results of a wide variety of studies from human and from informative model systems with techniques linking genes and pathways to physiology, from prokaryotes to eukaryotes. It is published 24 times a year (twice monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 the American Physiological Society. ESSN: 1531-2267. Visit our website at http://www.the-aps.org/.

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

This article has been cited by 17 other HighWire-hosted articles: http://physiolgenomics.physiology.org/content/20/3/256#cited-by

Physiol Genomics 18: 256–267, 2005. First published December 28, 2004; doi:10.1152/physiolgenomics.00165.2004.

Cardiac gene expression profile in rats with terminal heart failure and cachexia Maren Wellner,1 Ralf Dechend,1 Joon-Keun Park,3 Erdenechimeg Shagdarsuren,1 Nidal Al-Saadi,1 Torsten Kirsch,3 Petra Gratze,1 Wolfgang Schneider,1 Silke Meiners,4 Anette Fiebeler,1 Hermann Haller,3 Friedrich C. Luft,1,2 and Dominik N. Muller1,2 1

HELIOS Klinikum-Berlin, Franz Volhard Clinic, and Medical Faculty of the Charite´, Humboldt University of Berlin; 2Max-Delbru¨ck-Center for Molecular Medicine, Berlin-Buch; 3Department of Medicine-Nephrology, Hannover Medical School, Hannover; and 4Department of Cardiology, Charite´ Campus Mitte, Berlin, Germany Submitted 28 July 2004; accepted in final form 17 December 2004

double transgenic rats; angiotensin II; cardiac damage; hypertrophy; Affymetrix gene array HEART FAILURE IS A COMMON SEQUEL to pathological cardiac hypertrophy. Many proteins and genes are altered in cardiac hypertrophy (22). Less is known about protein and gene expression in the transition from hypertrophy to heart failure. Gene array technologies allow us to investigate thousands of genes simultaneously and to compare gene expression pattern under different pathological conditions. Various studies analyzing nonfailing heart and end-stage dilated cardiomyopathy

Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org). Address for reprint requests and other correspondence: D. N. Muller, Franz Volhard Clinic and Max-Delbru¨ck-Center, Wiltberg Strasse 50, 13125 Berlin, Germany (E-mail: [email protected]). 256

expression profiles have identified interesting known and unknown genes (6, 18). We are investigating a double transgenic rat (dTGR) model harboring the human angiotensinogen and renin genes (15, 29, 30). These rats develop hypertension, cardiac hypertrophy, proteinuria, and renal failure. Their mortality is ⬃50% at age 7 wk. All 7-wk-old dTGR show cardiac hypertrophy and preserved systolic function but impaired diastolic filling. However, a subset of animals develops terminal heart failure (THF), loses about up to one-quarter of their body weight within 2–3 days, and quickly dies thereafter (29, 30). Their physical condition resembles the clinical features of heart failure with cachexia (3). The molecular mechanisms that take place in a very few days from a hypertrophied heart to THF accompanied by cachexia are not understood. Gene expression studies are able to elucidate a large number of expected and undiscovered genes and pathways. The purpose of our study was to distinguish THF-dTGR from dTGR functionally and to possibly elucidate molecular mechanisms underlying the transition from compensated hypertrophy to THF with cachexia. We used an Affymetrix chip array approach to determine gene expression profiles. From our list of differentially expressed genes (239 increased and 150 decreased transcripts; THFdTGR vs. dTGR), we selected two pathways for detailed analysis. First, we investigated heat shock proteins (HSPs) and markers of inflammation, immunity, and tissue repair. Second, we focused on genes of the metabolic pathway that might be interesting not only for the cachetic but also for the cardiac phenotype of THF-dTGR. METHODS

Experimental animals. Rats overexpressing the human renin and angiotensinogen genes have been described in detail (15, 29, 30). dTGR were purchased from RCC (Fu¨llinsdorf, Switzerland). Experiments were conducted in age-matched 4-wk-old male untreated dTGR, losartan (LOS)-treated dTGR (n ⫽ 12; 10 mg䡠kg⫺1䡠day⫺1 in the diet for 3 wk), and nontransgenic Sprague-Dawley rats (SD) (Tierzucht Scho¨nwalde, Scho¨nwalde, Germany; n ⫽ 8) after due approval from the Local Animal Authorities of the County of Berlin, Germany (permit no. G408/97). Untreated dTGR were divided in two subgroups, rats with cardiac hypertrophy (n ⫽ 18) and rats with THF (n ⫽ 8). We defined criteria for THF as follows: marked decline in physical activity (lethargy) and loss of body weight for 3 consecutive days. Both are criteria of the German Animal Care Authorities. Systolic blood pressure was measured by tail cuff under light ether anesthesia. We could not measure filling pressures or stroke volume directly but instead relied on echocardiography. Echocardiography (M-mode tracings at short axis; n ⫽ 5/group) was performed using a commercially available system equipped with a 15-MHz phased-array transducer under light ether anesthesia (29). Three measurements per heart were determined, averaged, and analyzed. Tissue Doppler with the sample volume in the basal septum in a four-chamber view was

1094-8341/05 $8.00 Copyright © 2005 the American Physiological Society

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

Wellner, Maren, Ralf Dechend, Joon-Keun Park, Erdenechimeg Shagdarsuren, Nidal Al-Saadi, Torsten Kirsch, Petra Gratze, Wolfgang Schneider, Silke Meiners, Anette Fiebeler, Hermann Haller, Friedrich C. Luft, and Dominik N. Muller. Cardiac gene expression profile in rats with terminal heart failure and cachexia. Physiol Genomics 18: 256–267, 2005. First published December 28, 2004; doi:10.1152/physiolgenomics.00165.2004.—About one-half of double transgenic rats (dTGR) overexpressing the human renin and angiotensinogen genes die by age 7 wk of terminal heart failure (THF); the other (preterminal) one-half develop cardiac damage but survive. Our study’s aim was to elucidate cardiac gene expression differences in dTGR-THF compared with dTGR showing compensated cardiac hypertrophy but not yet THF. dTGR treated with losartan (LOS) and nontransgenic rats (SD) served as controls. THFdTGR body weight was significantly lower than for all other groups. At death, THF-dTGR had blood pressures of 228 ⫾ 7 mmHg (cardiac hypertrophy index 6.2 ⫾ 0.1 mg/g). Tissue Doppler showed reduced peak early (Ea) to late (Aa) diastolic expansion in THF-dTGR, indicating diastolic function. Preterminal dTGR had blood pressures of 197 ⫾ 5 mmHg (cardiac hypertrophy index 5.1 ⫾ 0.1 mg/g); Ea ⬍ Aa compared with LOS-dTGR (141 ⫾ 6 mmHg; 3.7⫾0.1 mg/g; Ea ⬎ Aa) and SD (112 ⫾ 4 mmHg; 3.6 ⫾ 0.1 mg/g; Ea ⬎ Aa). Left ventricular RNA was isolated for the Affymetrix system and TaqMan RT-PCR. THF-dTGR and dTGR showed upregulation of hypertrophy markers and ␣/␤-myosin heavy chain switch to the fetal isoform. THF-dTGR (vs. dTGR) showed upregulation of 239 and downregulation of 150 genes. Various genes of mitochodrial respiratory chain and lipid catabolism were reduced. In addition, genes encoding transcription factors (CEBP-␤, c-fos, Fra-1), coagulation, remodeling/ repair components (HSP70, HSP27, heme oxygenase), immune system (complement components, IL-6), and metabolic pathway were differentially expressed. In contrast, LOS-dTGR and SD had similar expression profiles. These data demonstrate that THF-dTGR show an altered expression profile compared with preterminal dTGR.

CARDIAC GENE EXPRESSION IN DTGR

background and cross-hybridization signals. To determine the quantitative RNA abundance, the average of differences representing PM minus MM for each specific probe family was calculated, after discarding the maximum, the minimum, and any outliers beyond three standard deviations. Expression values were compared between the THF-dTGR and dTGR as well as LOS-treated and SD rats. The microarray data were prepared according to Minimum Information about a Microarray Experiment recommendations (9), have been submitted in the Gene Expression Omnibus (GEO) database, and can be accessed at http://www.ncbi.nlm.nih.gov/geo. The GEO accession no. for the platform is GSE1557. The four samples can be retrieved with GEO accession nos. GSM26710, GSM26711, GSM26712, and GSM26713. TaqMan RT-PCR confirmed the gene expression level from the left ventricle. TaqMan analysis was conducted according to the manufacturer’s instructions, using an Applied Biosystems 7700 Sequence Detector (Applied Biosystems, Darmstadt, Germany). Each sample (n ⫽ 6–8/group) was measured in triplicate, and expression level was normalized to 18S expression with the standard curve method. The TaqMan primer sets are listed in TAQMAN PROBE AND PRIMER SETS USED. For ␣-myosin heavy chain (MHC), ␤-MHC, atrial natriuretic peptide (ANP), and sarcoplasmic reticulum Ca2⫹-ATPase (SERCA)2a, quantitative RT-PCR amplification was carried out in 25 ␮l of SybrGreen PCR Master Mix (Applied Biosystems) containing 0.3 or 0.9 mol/l primer and 1 ␮l of the reverse transcription reaction in a 5700 Sequence Detection System (Applied Biosystems). Thermal cycling conditions comprised an initial denaturation step at 95°C for 10 min, followed by 95°C for 15 s and 65°C for 1 min for 40 cycles. The mRNA expression was standardized to the hypoxanthine phosphoribosyl transferase gene as a housekeeping gene (39).

Fig. 1. A: systolic blood pressure was higher in terminal heart failure (THF)-double transgenic rats (dTGR) and dTGR than in losartan (LOS)-treated dTGR and nontransgenic Sprague-Dawley rats (SD; P ⬍ 0.001). THFdTGR tended to have increased blood pressure levels compared with dTGR (P ⫽ 0.051). B: THF-dTGR and dTGR showed increased 24-h albuminuria compared with both other groups (P ⬍ 0.001), whereas LOS-treated dTGR were not different from SD. C: body weight was decreased in THFdTGR compared with all other groups. D: a representative cardiac section shows an area of fresh myocardial necrosis in THF-dTGR. Results are means ⫾ SE; n ⫽ 6–10. *P ⬍ 0.05 vs. THF-dTGR. #P ⬍ 0.05 vs. dTGR.

Physiol Genomics • VOL

18 •

www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

done to measure the velocity of the longitudinal cardiac movement at the basal septum, allowing assessment of diastolic filling. Velocity range, gain, and filter settings were optimized to detect low velocities, and the pulsed-wave Doppler spectrum was displayed at 200 mm/s. The measurements represent velocities of peak early (Ea) and late (Aa) diastolic expansion. The Ea-to-Aa ratio (Ea/Aa) is reported as an index of diastolic function. Urine samples were collected over 24 h. Urinary albumin was measured by ELISA (CellTrend). Rats were killed at age 7 wk. For RNA analysis tissues were snap frozen in liquid nitrogen, and for immunohistochemistry in ⫺40°C cold isopentane, and stored at ⫺80°C. RNA isolation, Affymetrix microarray, and TaqMan analysis. Total RNA (5 animals/group) was isolated from the left ventricle with the use of Qiashredder and RNeasy spin columns, including chromosomal DNase digestion (Qiagen, Hilden, Germany). Twenty micrograms of total RNA were reverse transcribed into cDNA with the use of oligo(dT)24 primers containing a T7 RNA polymerase promoter. In vitro transcription was performed in the presence of biotin-labeled CTP and UTP (Enzo Diagnostics, Framingdale, NY) on doublestranded cDNA using Megascript T7 kit (Ambion, Huntingdon, UK). Parallel analysis of gene expression was carried out. Labeled cRNA were used as the target in the hybridization process. Hybridizations were performed overnight; gene chips were washed and stained with streptavidin-phycoerythrin. A laser-scanning technique determined the data, and pixel levels were analyzed with Affymetrix software (7). Detailed protocols for data analysis of Affymetrix microarrays have been described (24). The Affymetrix Gene-Chip U34A represents 8,800 genes and expressed sequence tags (Affymetrix, Woodburn Green, UK). Each gene was represented by the use of 20 perfectly matched (PM) and mismatched (MM) control probes. The MM probes acted as specificity controls that allowed the direct subtraction of both

257

258

CARDIAC GENE EXPRESSION IN DTGR RESULTS

We found that a subset of untreated dTGR developed cachexia and signs of cardiac failure (THF-dTGR). In contrast, a preterminal dTGR subset exhibited cardiac hypertrophy without loss of body weight. At death, THF-dTGR had blood pressures of 228 ⫾ 7 mmHg, which was slightly higher than untreated dTGR (197 ⫾ 5 mmHg; P ⫽ 0.051). Both dTGR subgroups showed significantly elevated systolic blood pressure levels compared with LOS-dTGR and nontransgenic SD rats (141 ⫾ 6 and 112 ⫾ 4 mmHg, respectively; P ⬍ 0.01; Fig. 1A). THF-dTGR and preterminal dTGR showed severe albuminuria. LOS treatment reduced albuminuria toward the SD level (Fig. 1B). THF-dTGR lost about 10–20% of their body weight within the last 2–3 days (Fig. 1C), leading to decreased body weight compared with all other groups (P ⬍ 0.05). All THF-dTGR showed areas of myocardial necrosis. A represen-

Fig. 2. A: THF-dTGR and dTGR showed increased cardiac mass compared with both other groups (P ⬍ 0.01), whereas LOS-treated dTGR were not different from SD. B and C: heart weight-to-tibia length as well as heart-to-body weight ratios were increased in THF-dTGR and dTGR compared with LOS-treated dTGR and SD. Because of loss of body weight, heart-to-body weight ratio was further increased in THF-dTGR vs. dTGR. D: cardiac fibronectin expression in THF-dTGR and dTGR was significantly increased compared with LOS-treated dTGR and SD. Results are means ⫾ SE; n ⫽ 6–10. *P ⬍ 0.05 vs. THF-dTGR. #P ⬍ 0.05 vs. dTGR.

Physiol Genomics • VOL

18 •

www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

Immunohistochemistry. Ice-cold acetone-fixed cryosections (6 ␮m) were stained by immunofluorescence and the alkaline phosphatase (APAAP) technique as described earlier (29, 30). The sections were incubated with the monoclonal antibodies anti-CD4 (Pharmingen), anti-ED-1 (Serotec), and anti-CD86 (Pharmingen) and the polyclonal antibodies anti-IL-6, anti-HSP70 (Stressgene), and anti-fibronectin (Paesel). Cy3 and FITC secondary antibodies (Dianova) were used for colocalization stainings. Semiquantitative scoring of infiltrated cells and matrix expression was performed as described earlier (30). Statistical analysis. Data are presented as means ⫾ SE. Statistically significant differences in mean values were tested by ANOVA, with repeated measures when appropriate, followed by Student’s t-test. A value of P ⬍ 0.05 was considered statistically significant. The data were analyzed using Statview statistical software. For Affymetrix microarray analysis, we used the Affymetrix microarray suite program. Genes with P value ⬍ 0.01 were considered to be differentially expressed between THF-dTGR and dTGR as well as dTGR and LOS-treated-dTGR.

259

CARDIAC GENE EXPRESSION IN DTGR

tative example is given in Fig. 1D. THF-dTGR and dTGR both showed increased cardiac mass (Fig. 2A) and heart-to-tibia ratio (Fig. 2B) as well as heart-to-body weight ratio (Fig. 2C) compared with LOS-treated dTGR and SD. Despite identical heart weights, THF-dTGR also showed a higher heart-to-body mass ratio compared with preterminal dTGR (Fig. 2C), indicating that THF-dTGR did not lose cardiac mass during cachexia development. Matrix protein deposition, determined as fibronectin staining by immunofluorescence, showed that fibronectin was markedly expressed in THF-dTGR and dTGR compared with SD. LOS-dTGR showed markedly reduced fibronectin expression toward SD staining (Fig. 2D). Several hypertrophy markers were increased in THF-dTGR and preterminal dTGR. ANP mRNA expression (Fig. 3A) in the left ventricles was increased in THF-dTGR and dTGR compared with LOS-treated dTGR and SD. Whereas ANP mRNA expression was similar in THF-dTGR and dTGR, left ventricles from THF-dTGR showed significantly increased c-fos expression compared with all groups (Fig. 3B). Furthermore, both groups showed a shift of ␣-MHC to ␤-MHC phenotype, indicating cardiac hypertrophy (Fig. 3, C–D). TaqMan RT-PCR also confirmed that the SERCA2a was decreased in THF-dTGR and dTGR compared with both other groups. LOS treatment restored the decreased expression of THFdTGR and dTGR (Fig. 3E). Echocardiography confirmed the increased left ventricular wall thickness in preterminal dTGR and THF-dTGR, which was reduced to the SD level by LOS Physiol Genomics • VOL

18 •

(Table 1). Using mitral valve Doppler, we demonstrated that preterminal dTGR and THF-dTGR showed signs of diastolic dysfunction (Ea ⬍ Aa), again normalized by LOS. Systolic function, measured by fractioning shortening, was similar in all four groups. We compared the expression profiles of THF-dTGR vs. dTGR with preterminal cardiac hypertrophy with Affymetrix gene chips to better understand the transition from hypertrophy to heart failure with cachexia. We identified 239 transcripts that were significantly increased and 150 transcripts that were decreased in THF-dTGR compared with dTGR. Table 2 lists 56 selected known transcripts that were differentially exTable 1. Echocardiographical analysis

THF-dTGR dTGR dTGR ⫹ LOS SD

LV Wall Thickness, cm

IVS, cm

LV FS, %

0.28⫾0.01 0.24⫾0.02 0.12⫾0.01*† 0.15⫾0.01*†

0.28⫾0.02 0.24⫾0.02‡ 0.12⫾0.02*† 0.14⫾0.01*†

67⫾5 58⫾3 59⫾2 55⫾3

End-Diastolic Dysfunction (Ea/Aa)

Ea Ea Ea Ea

⬍ ⬍ ⬎ ⬎

Aa Aa Aa Aa

Data are means ⫾ SE. THF, terminal heart failure; dTGR, double transgenic rats; LOS, losartan; SD, nontransgenic Sprague-Dawley rats; LV, left ventricle; IVS, intraventricular septum; FS, fractioning shortening; Ea/Aa; Ea-to-Aa ratio. Velocities of peak early (Ea) and late (Aa) diastolic expansion are reported as an index of diastolic function. *P ⬍ 0.05, THF-dTGR vs. other groups. †P ⬍ 0.05, dTGR vs. other groups. ‡P ⬍ 0.05, THF-dTGR vs. dTGR.

www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

Fig. 3. A: atrial natriuretic peptide (ANP) mRNA expression is increased in THF-dTGR and dTGR compared with both other groups. B: c-fos was increased in THF-dTGR. C and D: left ventricular mRNA from THF-dTGR and dTGR shows a shift from ␣- to ␤-myosin heavy chain (MHC) expression, whereas LOS-treated dTGR and SD behaved vice versa. E: sarcoplasmic reticulum Ca2⫹-ATPase (SERCA)2a was significantly reduced in dTGR and THF-dTGR compared with both other groups. Results are means ⫾ SE; n ⫽ 6–10. *P ⬍ 0.05 vs. THF-dTGR. #P ⬍ 0.05 vs. dTGR.

260

CARDIAC GENE EXPRESSION IN DTGR

Table 2. Differential gene expression in THF-dTGR vs. preterminal dTGR THF vs. dTGR, fold change

Classification

Subclassification

S68135 AA799760 D63772 L25387 X02231 AF034577 J05210 AA944025 AI105050 X72757 X15030 AB013732 AF080468 X07320 J05029 D90109 D43623 U72497 J02773

4.2 0.4 2.1 2.1 2.0 4.1 2.0 2.0 0.5 0.5 0.4 2.0 0.4 0.5 0.6 0.5 0.7 0.7 0.4

metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism metabolism

carrier carrier carrier glucose glycolysis glucose glycolysis carbohydrate metabolism citric acid cycle citric acid cycle oxidative phosphorylation oxidative phosphorylation oxidative phosphorylation pentose phosphate pathway gluconeogenesis glycogenmetabolism lipid catabolism lipid catabolism lipid catabolism lipid catabolism lipid catabolism

AF036548 AB003042 X71127 M26744 L06040 Z27118 M86389 AI179610 AA874926 M10094 M18842 X06769 M19651 AI045030 X60769 AA900476 AA891041 Y00396 AJ000557

2.0 8.1 2.0 8.0 2.1 16.2 1.4 2.0 8.2 4.3 4.1 4.2 4.3 2.0 2.1 2.1 2 2 8.3

X02412 M34134 AI105374 M80829

0.4 0.4 4.1 0.5

hypertrophy hypertrophy hypertrophy hypertrophy

sarcomeric sarcomeric sarcomeric sarcomeric

M24067 M23697 X71898 U50044 AI169327 S66184 AA899106 U24174 U38253 U63923 AA965261 U73142 X57764 J03754

8.0 2.1 2.1 4.2 4.1 4.1 2.0 4.2 8.4 2.1 2.1 4.1 2.1 0.1

other other other other other other other other other other other other other other

coagulation coagulation coagulation coagulation ECM ECM cell cycle cell cycle translation regulation oxidative stress chromosomal protein signal transduction receptor Ca2⫹ metabolism

immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity

complement system complement system cytokine HSP HSP HSP

transcription transcription transcription transcription transcription transcription transcription transcription

pressed in THF-dTGR compared with dTGR. Various genes determining immunity and inflammation and promoting extracellular matrix formation, coagulation, and tissue repair were increased. Interestingly, several genes regulating mitochondrial energy production were decreased. Physiol Genomics • VOL

18 •

factor factor factor factor factor factor factor factor

proteins proteins proteins proteins

Description

GLUT1 glucose transporter 1 GLUT4 glucose transporter 4 GLUT5 glucose transporter 5 phosphofructokinase C (PFK-C) GAPDH pyruvate dehydrogenase kinase isoenzyme 4 ATP citrate-lyase isocitrate dehydrogenase 1 ATP synthase beta cox VIa gene mitochondrial cytochrome c oxidase subunit Va UDP-glucose dehydrogenase glucose-6 phosphatase phosphorylase kinase gamma long-chain acyl-CoA dehydrogenase long-chain acyl-CoA synthetase camitine palmitoyltransferase 1 fatty acid amide hydrolase low-molecular-weight fatty acid-binding protein integrin beta 1 (fibronectin receptor beta) C5a receptor complement protein C1q beta chain interleukin-6 (IL6) 12-lipoxygenase heat shock protein 70 heat shock protein 27 heme oxygenase major histocompatibility complex MHC class I truncated cell surface antigen T-cell receptor active beta-chain V-region c-fos fos-related antigen (Fra-1) CCAAT/enhancer binding protein delta CCAAT/enhancer binding protein beta Cbp/p300-interacting transactivator Jun B c-myc Janus protein tyrosine kinase 2, JAK2 alpha tropomyosin tropomyosin-1 tropomyosin-4 troponin T plasminogen activator inhibitor-1 (PAI-1) tissue-type plasminogen activator (t-PA) uPAR-1 urinary plasminogen activator receptor-1 von Willebrand factor vWf, precursor mRNA tissue inhibitor of metalloprotease-1 (TIMP1) lysyl oxidase cyclin D2 p21 (WAF1) initiation factor elF-2B gamma (elF-2B gamma) thioredoxin reductase mRNA H2a histone family p38 mitogen-activated protein kinase ET-B endothelin receptor plasma membrane Ca2⫹ ATPase isoform-2

A variety of genes involved in energy metabolism were altered between THF-dTGR and dTGR. Our array data show that the insulin-dependent glucose transporter GLUT4 was decreased. In contrast, GLUT1 was increased in THF-dTGR compared with dTGR. Two other mRNAs encoding glycolytic www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

Accession No.

CARDIAC GENE EXPRESSION IN DTGR

creased, we analyzed cell infiltration into the heart more closely. Monocytes and macrophages (ED-1⫹ cells; Fig. 6D), CD4 T-cells (Fig. 6E), and CD86⫹ cells (data not shown) infiltrated more frequently into the hearts of THF-dTGR and dTGR compared with LOS-dTGR and SD. DISCUSSION

We found distinct differences in myocardial gene expression in THF-dTGR, dTGR, LOS-dTGR, and SD controls. THFdTGR were indeed terminally ill. Some rats died before we could euthanize them. THF-dTGR were slightly more hypertensive and clearly weighed less than dTGR. Echocardiography demonstrated similar systolic function; however, the diastolic function was poorer and matrix protein expression was increased in THF-dTGR. When we compared THF-dTGR with dTGR in terms of gene expression, we identified 239 transcripts that were increased in expression and 150 transcripts that were decreased. These transcripts presumably represent the genes and gene families that are important to THF with accompanying cachexia. Hypertrophy occurs as a compensatory, adaptive response to increased workload by which myocardial wall stress is restored. However, cardiac hypertrophy is an independent risk factor for the development of myocardial infarction, sudden death, and congestive heart failure. After a prolonged period of compensatory adaptation of cardiac hypertrophy with a restored wall stress, myocardial exhaustion occurs with heart failure development. The underlying mechanisms of this change from compensated hypertrophy to heart failure are not known. However, an alteration in energy metabolism may contribute to this disease evolution. Taegtmeyer (43) formed the concept of “genetics of energetics.” This hypothesis implicates a dynamic interaction between gene expression, energy substrate metabolism, and heart function. A certain metabolic status induces the activity of transcription factors and/or regulates metabolic gene transcription, which alters cardiac function and vice versa. A dynamic adaptation to cardiac hypertrophy and failure has been characterized for sarcomeric gene expression. This adaptation is characterized by a switch of sarcomeric proteins from “adult” to “fetal” isoform, the induction of growth factors, and the reexpression of protooncogenes. We showed that IL-6,

Fig. 4. Glucose transporters GLUT1 and GLUT4 and phosphofructokinase (PFK) mRNA expression was measured by TaqMan RT-PCR in THF-dTGR, dTGR, LOS-treated rats, and SD and confirmed the results from the array data. Results are means ⫾ SE; n ⫽ 6–10. *P ⬍ 0.05 vs. THF-dTGR. #P ⬍ 0.05 vs. dTGR.

Physiol Genomics • VOL

18 •

www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

enzymes were elevated, the glycolytic key enzyme phosphofructokinase (PFK) and GAPDH. We confirmed some of these changes with TaqMan PCR. GLUT1, GLUT4, and PFK mRNA expression is shown in Fig. 4. Our chip experiment also showed that phosphorylase kinase, an enzyme involved in glycogen catabolism, and glucose-6phosphatase, which is involved in gluconeogenesis, were decreased twofold. ATP citrate lyase, necessary for fatty acid synthesis, was twofold increased. Mitochondrial respiratory chain components (cytochrome B, cytochrome c oxidase, ATP synthase) were decreased in THF compared with dTGR. In addition, mRNAs involved in lipid catabolism (long-chain acyl-CoA synthetase, carnitine palmitoyltransferase I, longchain acyl-CoA dehydrogenase) were diminished. We next analyzed the expression pattern comparing both hypertrophic groups (THF-dTGR and dTGR) with chronically LOS-treated dTGR (Table 3). Cardionatrin precursor, also known as ANP, a marker of cardiac hypertrophy, genes of the cell cycle (cyclin D3, cyclin D2, cyclin D), HSPs (HSP70, HSP27), and genes of the MAPK pathway (heparin-binding EGF-like growth factor, p38 MAPK, c-fos, junB, fra) as well as various transcription factors (c-fos, fra, c-myc) were significantly increased in the left ventricles, whereas some nuclear receptors (growth hormone receptor, retinoic X receptor-␥) were decreased. We then selected various genes for further investigation. TaqMan PCR confirmed the relative expression pattern of the HSP70 (Fig. 5A), HSP27 (Fig. 5A), IL-6 (Fig. 6A), and hemeoxygenase (HO)-1 (Fig. 6C). In THF-dTGR, the HSP70 expression was induced 6-fold compared with dTGR and ⬃10fold compared with LOS-dTGR and SD, respectively. Immunohistochemistry showed that HSP70 immunoreactivity (Fig. 5B) was detected in the media of THF-dTGR and dTGR. In addition to the vascular localization, THF-dTGR showed areas with patchy areas of myocardial necrosis that also expressed HSP70. These areas were prominent in THF-dTGR and rare in dTGR. In LOS-dTGR and SD, HSP70 was not detectable in the myocardium. IL-6 and HO-1 mRNA showed responses very similar to HSP70 mRNA. IL-6 immunoreactivity was increased in the media of THF-dTGR and dTGR compared with LOS-dTGR and SD (data not shown). IL-6 and HSP70 immunostaining was coexpressed in the vascular wall of a coronary artery (Fig. 6B). Because the proinflammatory IL-6 was in-

261

262

CARDIAC GENE EXPRESSION IN DTGR

Table 3. Differential gene expression in THF-dTGR, preterminal dTGR, and LOS-treated dTGR Accession No.

THF vs. LOS, fold change

dTGR vs. LOS, fold change

Classification

U20643 J04526 AF062740 U83880 S81497 AB000778 M16235 J02722 M14656 M26744 AA900476 S77528 L20869 X71127 D26439 Z27118 M86389

3.5 2.0 0.5 0.5 0.5 0.5 0.2 18.4 27.9 6.1 14.9 13.0 4.9 3.0 0.5 16.2 7.5

2.0 2.1 0.5 0.4 0.5 0.2 0.3 8.4 4.3 1.1 4.0 16.0 1.4 1.4 0.5 1.9 4.1

metabolism metabolism metabolism metabolism metabolism metabolism metabolism immunity immunity immunity immunity immunity immunity immunity immunity immunity immunity

heat shock proteins heat shock proteins

aldolase A gene hexokinase mRNA pyruvate DH phosphatase-1 glycerol-3-phosphate dehydrate DH lysosomal acid lipase phospholipase D hepatic lipase mRNA heme oxygenase gene osteopontin IL-6 Cbp/p300-interacting transactivator C/EBP-related transcription factor pancreatitis-associated protein C1q beta CD1 antigen HSP70 heat shock protein 70 HSP27A heat shock protein 27

2.6 3.2 8.0 5.6

4.0 2.1 1.2 2.0

hypertrophy hypertrophy immunity immunity

sarcomeric protein transcription factor transcription factor

ANP ␤-tropomyosin fra c-fos

4.3 2.5 9.2 3.7 2.8 8.0 26.0 8.0 21.1 11.3 3.5 3.2 2.3 3.5 2.5 2.1 3.2 2.1 2.8 2.0 2.3 4.9 36.8 22.6 2.6 2.6 2.5 2.3 2.3 0.5 0.5 0.5 0.5 22.6 19.7 8.6 2.8 0.5 14.9

8.1 2.0 8.3 2.0 2.0 4.1 2.1 2.1 4.0 2.1 2.0 2.1 2.1 4.1 2.0 2.0 2.1 2.0 4.2 2.1 2.0 2.0 8.1 8.0 2.1 2.0 2.1 2.1 2.1 0.5 0.4 0.1 0.4 4.3 8.1 2.1 2.1 0.4 4.0

other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other other

Ca transport Ca transport cell cycle cell cycle cell cycle channel coagulation detoxification extracellular matrix extracellular matrix extracellular matrix extracellular matrix extracellular matrix membrane membrane membrane muscle muscle neuro neuro neuro oxidative stress signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction sorting transcription factor transcription factor transcription factor transcription factor transcription factor transport

EF-hand Ca2⫹-binding protein p22 calreticulin cyclin D3 gene cyclin D2 cyclin G sodium channel alpha-subunit plasminogen activator inhibitor-1 (PAI-1) metallothionein-2 and metalloproteinase-1 tissue inhibitor of metalloproteinase-1 lysyl oxidase versican V3 isoform precursor tissue inhibitor of metalloproteinase-3 thrombospondin-4 protein epithelial membrane protein-1 transmembrane protein Tmp21-1 transmembrane protein mp21.4 ␤-tropomyosin cytoplasmic ␤-actin calbindin D28 mRNA amyloid precursor-like protein 2 proenkephalin thioredoxin reductase mRNA protein-glutamine ␥-glutamyltransferase heparin-binding EGF-like growth factor GIT-1 mRNA PKC-zeta-interacting protein GTP-binding protein fibroblast growth factor receptor-1 beta Ras-related protein p23 growth hormone receptor retinoid X receptor gamma (RXRgamma) protein kinase (MUK) vacuolar protein sorting homolog r-vps33a CCAAT enhancer binding protein-delta c-myc oncogene CELF mRNA NF1-X1 Olf-1/EBF-associated Zn finger protein Roaz taurine transporter

X53363 U49935 D16308 X70871 M27902 M24067 M11794 AI169327 S66184 AF072892 U27201 X89963 Z54212 X97443 X92097 L00382 V01217 M31178 X77934 S49491 U63923 M57263 L05489 U32681 Y08355 D01046 S54008 X12535 Z83757 AF016387 D49785 U35244 AI045030 Y00396 M65149 AB012234 U92564 M96601 M80804

Physiol Genomics • VOL

glycolysis glycolysis

cytokine transcription factor transcription factor complement system

18 •

www.physiolgenomics.org

Description

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

E00775 L00382 M19651 X06769

Subclassification

CARDIAC GENE EXPRESSION IN DTGR

263

c-fos, and ANP are increased in the dynamic process from compensated hypertension to THF. We also found the downregulation of ␣-MHC in parallel with a ␤-MHC mRNA increase, representing the switch from adult to fetal isoform. In addition, SERCA2a was decreased in hypertrophied and failing dTGR hearts, which was reversed by chronic LOS treatment. In heart failure, abnormal calcium handling contributes to contractile dysfunction (16). The steady-state levels of SERCA2a are reduced in human heart failure due to dilated cardiomyopathy. Inducible SERCA2a expression improves calcium handling and reverts cardiac dysfunction in pressure overload-induced cardiac hypertrophy (6, 42). A recent study reported that IL-6 reduced SERCA mRNA and induced ANP mRNA expression in cultured rat ventricular myocytes. The investigators concluded that cardiac hypertrophy may result from the imbalance of both ANP and SERCA transcription levels, caused by elevated IL-6 expression (45). Furthermore, clinical studies have shown that circulating levels of IL-6 and other IL-6-related cytokines are increased in patients with congestive heart failure (37, 49). IL-6 is a pleiotropic cytokine with varying effects on cells of the immune system and other tissues. Angiotensin II stimulates IL-6 production in vascular smooth muscle cells and cardiac myocytes (36, 48). We demPhysiol Genomics • VOL

18 •

onstrated that IL-6 mRNA is enhanced in THF-dTGR left ventricles. Immunohistochemistry demonstrated IL-6 protein in smooth muscle cells of cardiac vessels colocalizing with HSP70, which is the highest differentially expressed gene in our chip experiment. The promoter/enhancer region of IL-6 contains response elements for nuclear factor (NF)-␬B, activator protein (AP)-1, and CCAAT/enhancer-binding protein (C/ EBP) (11, 25). In the present study, components of the AP-1 complex, C/EBP-␤ and -␦, and Janus kinase/signal transducers and activators of transcription were differentially expressed in THF-dTGR and dTGR compared with LOS-treated dTGR and SD. We have previously shown that cardiac NF-␬B and AP-1 DNA-binding activity is increased in dTGR. In a positivefeedback loop, gp130/IL-6 signaling induces C/EBP expression (20). HSPs function as molecular chaperones or proteases (8). They are induced by environmental stress, including heat shock, oxidative stress, ischemia, and reperfusion. HSPs interact with diverse substrates to assist in their folding and to prevent the appearance of folding intermediates that lead to misfolded or damaged molecules. Angiotensin II induces the expression of HSPs in cultured vascular smooth muscle cells, aorta, and kidney. HSP70 protects cells against apoptosis, www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

Fig. 5. A: heat shock protein (HSP)70 and HSP27 mRNA expression measured by TaqMan RT-PCR confirmed the Affymetrix chip analysis. Results are means ⫾ SE; n ⫽ 6–10. *P ⬍ 0.05 vs. THF-dTGR. B: HSP70 immunoreactivity (bright red) was observed in the vessel wall of THF-dTGR and dTGR. THF-dTGR showed the strongest signal, whereas LOS-treated dTGR and SD showed almost no signal. Inset: prominent immunoreactivity in THF-dTGR myocytes, which was rare in dTGR and not found in LOS-treated dTGR and SD hearts.

264

CARDIAC GENE EXPRESSION IN DTGR

perhaps by binding to proapoptotic proteins (28). Similar function has been attributed to HSP27 (8). Also of interest is the fact that HSPs participate in specific protective immunity (27). The molecules can elicit cytokine production and adhesion molecule expression. They can deliver maturation signals and peptides to antigen presenting cells through receptormediated interactions. Both innate and acquired immunity are involved in our angiotensin II-mediated organ damage in this model (30). Asea et al. (4) showed that HSP70 acts as a cytokine, activates NF-␬B, and upregulates the expression of proinflammatory cytokines TNF-␣, IL-1␤, and IL-6 in human monocytes. Infiltration of monocytes/macrophages is a typical feature of our transgenic model (29, 30). In the present study, we could also show that LOS treatment prevented infiltration of macrophages and T-cells as well as IL-6. We found high expression of HSP70 in cardiac vessel walls and colocalization with IL-6. HSP70 was highly expressed in presumably dying cardiomyocytes in THF-dTGR. Barrans et al. (6) showed in a microarray study that HSP70 was also upregulated in patients with end-stage dilated cardiomyopathy. Studies in spontaneously hypertensive rats (12) and in patients with essential hypertension (17) have demonstrated a decrease in myocardial fatty acid utilization. Sack and Kelly Physiol Genomics • VOL

18 •

(35) were the first to report that a number of genes encoding for the cardiac fatty acid oxidation enzymes (medium-chain acylCoA dehydrogenase, long-chain acyl-CoA dehydrogenase, and 3-OH long-chain acyl-CoA dehydrogenase) are downregulated in the hypertrophied and failing myocardium. During hypertrophy, the primary myocardial energy source switches from fatty acid ␤-oxidation to glycolysis, a reversion to the fetal energy substrate preference pattern (14, 44). Razeghi et al. (32) have characterized the expression profile of 13 key energy metabolism regulators in fetal, nonfailing, and failing adult hearts. Interestingly, they found that failing adult hearts reverted to the fetal phenotype profile by the downregulation of the adult genes rather than the upregulation of fetal genes. We also observed a downregulation of several adult genes, for example ␣-MHC, GLUT4, long-chain acyl-CoA dehydrogenase, and carnitine palmitoyltransferase I. In contrast to the study of Razeghi et al., in our dTGR model, ␤-MHC and GLUT1 were increased. We performed our rat experiments from week 4 to 7, a phase in which these relatively juvenile animals are still growing. Therefore, we cannot exclude the possibility that the age of our rats might have had an effect. Although the failing heart relies on glucose for energy production, enzymes controlling glucose utilization, especially www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

Fig. 6. A and C: IL-6 (A) and heme oxygenase (HO)-1 (C) mRNA expression measured by TaqMan RT-PCR showed results similar to the Affymetrix chip analysis. B: cardiac section showed colocalization of IL-6 (red) and HSP70 (green); merged area is orange. Lamina elastica interna show unspecific autofluorescence (green). D: LOS suppresses cell infiltration. E: THF-dTGR and dTGR showed increased infiltration of ED-1⫹ and CD4⫹ T-cells. Semiquantification (n ⫽ 5/group) showed that LOS reduced cell infiltration toward nontransgenic levels. All TaqMan results are expressed as means ⫾ SE of 6–10 animals/group. *P ⬍ 0.001 vs. THF-dTGR. #P ⬍ 0.01 vs. dTGR.

265

CARDIAC GENE EXPRESSION IN DTGR

Physiol Genomics • VOL

18 •

between gene expression and functional changes (contractile dysfunction) of the heart. Dysregulation of genes of fatty acid metabolism and glucose metabolism contributes to a state of starving of the failing heart, which is decremental in cardiac hypertrophy with an increased energy demand. Therapy aimed at modulating energy metabolism could be a new alternative approach to the improvement of a failing myocardium. Drugs that shift energy metabolism away from fatty acids to carbohydrates have been developed and are currently under trial (5, 41). Ventura-Clapier et al. (47) suggest that such a therapeutic strategy will cope with the proposal that “it is worthwhile to feed a tired energy-starved horse rather than whip the horse with inotropic agents.” Inhibition of the renin-angiotensin system has been shown to be beneficial in reversing the structural changes in hypertension and THF. However, the effect of renin-angiotensin system inhibition on the metabolic changes remains controversial and must be elucidated in future studies. TAQMAN PROBE AND PRIMER SETS USED

Table 4. c-fos-F c-fos-R c-fos HSP27-F HSP27-R HSP27 HSP70-F HSP70-R HSP70 18S-F 18S-R 18S HO-1-F HO-1-R HO-1 IL-6-F IL-6-R IL-6 GLUT1-F GLUT1-R GLUT1 GLUT4-F GLUT4-R GLUT4 PFK-F PFK-R PFK HPRT-F HPRT-R ANP-F ANP-R ␣-MHC-F ␣-MHC-R ␤-MHC-F ␤-MHC-R SERCA2a-F SERCA2a-R

CCATGATGTTCTCGGGTTTCA GCGCTACTGCAGCGGG FAM-CGCGGACTACGAGGCGTCATCC-TAMRA GACTGGTACCCTGCCCACAG ACCACTCATCGGGAAACCG FAM-CGCCTCTTCGATCAAGCTTTCGGG-TAMRA ACCAAGCAGACGCAGACCTT CCTCGTACACCTGGATCAGCA FAM-ACCTACTCGGACAACCAGCCCGG-TAMRA ACATCCAAGGAAGGCAGCAG TTTTCGTCACTACCTCCCCG FAM-CGCGCAAATTACCCACTCCCGAC-TAMRA GCTCCTGCGATGGGTCCT TGGCATAAATTCCCACTGCC FAM-ACACTCAGTTTCCTGTTGGCGACCG-TAMRA TGTCTCGAGCCCACCAGG TGCGGAGAGAAACTTCATAGCTG FAM-CGAAAGTCAACTCCATCTGCCCTTCAGG-TAMRA GGTGTGCAGCAGCCTGTGT CACAGTGAAGGCCGTGTTGA FAM-TGCCACCATCGGCTCGGGTATC-TAMRA TGGAAAGAGAGCGTCCACTGT CAATAATCAGAGGCTGCCGG FAM-TCCTGGGCAGCCGCACCC-TAMRA GCCACAAGATGTTCGCAATCT CCGATTTCTTTGATTTGGCC FAM-CGGCTTTGATGGCCTCGCCA-TAMRA ACTTGCTCGAGATGTCATGAAGG GTAATCCAGCAGGTCAGCAAAGA AGTGGCAATGCGACCAAGCTGT TCGCAAAAGATCCCAAGCCCTT AACGCCCAAGCCCGCTTGAA CATTGGCACGGACTGCGTCA GAGCCTCCAGAGTTTGCTGAAGGA TTGGCACGGACTGCGTCATC CGGCAGCCCTTGGGTT GACCATCCGTCACCAGATTGA

ACKNOWLEDGMENTS We thank May-Britt Ko¨hler, Mathilde Schmidt, Reika Langanki, Jana Czychi, Ute Gerhard, and Andrea Weller for excellent technical assistance.

www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

glucose transport, phosphorylation, and oxidation are reduced. Myocardial glucose uptake relies strongly on the glucose transporters GLUT1 and GLUT4 (1, 31). We found that the left ventricles of THF-dTGR showed markedly increased GLUT1 mRNA. These values were less strongly but nonetheless enhanced in dTGR compared with SD rats. Elevated GLUT1 mRNA expression is not surprising, since GLUT1 is regulated via the MAPK/AP-1 pathway. We showed earlier that AP-1 DNA binding activity is increased in dTGR hearts (29). In contrast, GLUT4 was decreased in THF-dTGR rats compared with all other rat groups. Experiments in GLUT4-deficient mice suggest an important role of GLUT4 in the development of cardiac hypertrophy. A complete GLUT4 knockout mouse and a cardiac-specific knockout both showed cardiac hypertrophy (2, 21). Cardiac-specific GLUT4 knockout mice did not exhibit differences in glucose tolerance, insulin, or other metabolic substrates (2). These findings indicate that GLUT4 plays a role in the development of hypertrophy independently of its metabolic function. On the other hand, exogenous glycolysis is accelerated (40). On the mRNA level, we found that the key enzyme of the glycolytic metabolic pathway, PFK, was increased in THF-dTGR and dTGR. On the protein level, in cardiac muscle cells ATP and citrate concentrations are so high that the enzyme would be completely inhibited and therefore could not act as an allosteric regulated key enzyme (38). Interestingly, PFK mRNA was markedly higher in spontaneously hypertensive rats compared with control rats and remained unchanged by exercise training-induced cardiac hypertrophy compared with controls (19). Mitochondrial function changes during development and is altered in failing human hearts (10, 32). We found a decrease in three of seven mitochondrial multicomplex units in THFdTGR with our chip approach (cytochrome B, cytochrome c oxidase, ATP synthase). Ruppert et al. (33) recently described similar results by sequencing novel point mutations in the mitochondrial NADH dehydrogenase and cytochrome c oxidase detected in patients with dilated cardiomyopathy. Mutations altering the function of the respiratory chain enzyme subunits could be relevant for the pathogenesis of cardiac hypertrophy. In addition, enzyme activities of the cytochrome c oxidase and NADH dehydrogenase in pigs with a naturally occurring hypertrophic cardiomyopathy were lower than those in the controls (23). Aside from the reduced expression, one alternative mechanism for the loss of mitochondrial enzyme activity might be related to reactive oxygen species (ROS)mediated mitochondrial DNA damage (46). ROS production also contributes to the development of heart failure. Xanthine oxidase activity is enhanced during heart failure (13). Various groups have reported that xanthine oxidase inhibition improved mechanoenergetic coupling in pacing-induced heart failure (13, 34). We found earlier that oxypurinol, a xanthine oxidase inhibitor, reduced ROS generation and ameliorated end-organ damage in the dTGR model (26). Thus mitochondrial enzyme deficiency and ROS-induced mitochondrial DNA damage might be involved in the pathogenesis of cardiac hypertrophy. In summary, genes implicated in energy metabolism were highly represented in our gene expression experiment. We found the expression of these genes to be changed in THFdTGR and dTGR compared with other groups. Recent evidence suggests that energy substrate metabolism forms the link

266

CARDIAC GENE EXPRESSION IN DTGR

GRANTS These studies were supported by grants-in-aid from the Deutsche Forschungsgemeinschaft and by the Nationales Genomnetzwerk (NGNF) (to D. N. Muller). D. N. Muller holds a Helmholtz Fellowship. REFERENCES

19.

20.

Physiol Genomics • VOL

18 •

21. 22. 23. 24.

25.

26.

27. 28.

29.

30.

31.

32. 33.

34.

35. 36.

www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

1. Abel ED. Glucose transport in the heart. Front Biosci 9: 201–215, 2004. 2. Abel ED, Kaulbach HC, Tian R, Hopkins JC, Duffy J, Doetschman T, Minnemann T, Boers ME, Hadro E, Oberste-Berghaus C, Quist W, Lowell BB, Ingwall JS, and Kahn BB. Cardiac hypertrophy with preserved contractile function after selective deletion of GLUT4 from the heart. J Clin Invest 104: 1703–1714, 1999. 3. Ajayi AA, Adigun AQ, Ojofeitimi EO, Yusuph H, and Ajayi OE. Anthropometric evaluation of cachexia in chronic congestive heart failure: the role of tricuspid regurgitation. Int J Cardiol 71: 79–84, 1999. 4. Asea A, Kraeft SK, Kurt-Jones EA, Stevenson MA, Chen LB, Finberg RW, Koo GC, and Calderwood SK. HSP70 stimulates cytokine production through a CD14-dependant pathway, demonstrating its dual role as a chaperone and cytokine. Nat Med 6: 435–442, 2000. 5. Ashrafian H. Cardiac energetics in congestive heart failure. Circulation 105: e44–e45, 2002. 6. Barrans JD, Allen PD, Stamatiou D, Dzau VJ, and Liew CC. Global gene expression profiling of end-stage dilated cardiomyopathy using a human cardiovascular-based cDNA microarray. Am J Pathol 160: 2035– 2043, 2002. 7. Barta P, Monti J, Maass PG, Gorzelniak K, Muller DN, Dechend R, Luft FC, Hubner N, and Sharma AM. A gene expression analysis in rat kidney following high and low salt intake. J Hypertens 20: 1115–1120, 2002. 8. Benjamin IJ and McMillan DR. Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res 83: 117–132, 1998. 9. Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, Aach J, Ansorge W, Ball CA, Causton HC, Gaasterland T, Glenisson P, Holstege FC, Kim IF, Markowitz V, Matese JC, Parkinson H, Robinson A, Sarkans U, Schulze-Kremer S, Stewart J, Taylor R, Vilo J, and Vingron M. Minimum information about a microarray experiment (MIAME)—toward standards for microarray data. Nat Genet 29: 365–371, 2001. 10. Buchwald A, Till H, Unterberg C, Oberschmidt R, Figulla HR, and Wiegand V. Alterations of the mitochondrial respiratory chain in human dilated cardiomyopathy. Eur Heart J 11: 509–516, 1990. 11. Chandrasekar B, Mitchell DH, Colston JT, and Freeman GL. Regulation of CCAAT/enhancer binding protein, interleukin-6, interleukin-6 receptor, and gp130 expression during myocardial ischemia/reperfusion. Circulation 99: 427–433, 1999. 12. Christe ME and Rodgers RL. Altered glucose and fatty acid oxidation in hearts of the spontaneously hypertensive rat. J Mol Cell Cardiol 26: 1371–1375, 1994. 13. Ekelund UE, Harrison RW, Shokek O, Thakkar RN, Tunin RS, Senzaki H, Kass DA, Marban E, and Hare JM. Intravenous allopurinol decreases myocardial oxygen consumption and increases mechanical efficiency in dogs with pacing-induced heart failure. Circ Res 85: 437–445, 1999. 14. Frey N and Olson EN. Modulating cardiac hypertrophy by manipulating myocardial lipid metabolism? Circulation 105: 1152–1154, 2002. 15. Ganten D, Wagner J, Zeh K, Bader M, Michel JB, Paul M, Zimmermann F, Ruf P, Hilgenfeldt U, Ganten U, Kaling M, Bachmann S, Fukamizu A, Mullins JJ, and Murakami K. Species specificity of renin kinetics in transgenic rats harboring the human renin and angiotensinogen genes. Proc Natl Acad Sci USA 89: 7806–7810, 1992. 16. Gwathmey JK, Copelas L, MacKinnon R, Schoen FJ, Feldman MD, Grossman W, and Morgan JP. Abnormal intracellular calcium handling in myocardium from patients with end-stage heart failure. Circ Res 61: 70–76, 1987. 17. Hajri T, Ibrahimi A, Coburn CT, Knapp FF Jr, Kurtz T, Pravenec M, and Abumrad NA. Defective fatty acid uptake in the spontaneously hypertensive rat is a primary determinant of altered glucose metabolism, hyperinsulinemia, and myocardial hypertrophy. J Biol Chem 276: 23661– 23666, 2001. 18. Hwang JJ, Allen PD, Tseng GC, Lam CW, Fananapazir L, Dzau VJ, and Liew CC. Microarray gene expression profiles in dilated and hyper-

trophic cardiomyopathic end-stage heart failure. Physiol Genomics 10: 31–44, 2002. Iemitsu M, Miyauchi T, Maeda S, Sakai S, Fujii N, Miyazaki H, Kakinuma Y, Matsuda M, and Yamaguchi I. Cardiac hypertrophy by hypertension and exercise training exhibits different gene expression of enzymes in energy metabolism. Hypertens Res 26: 829–837, 2003. Kamaraju AK, Adjalley S, Zhang P, Chebath J, and Revel M. C/EBP-delta induction by gp130 signaling. Role in transition to myelin gene expressing phenotype in a melanoma cell line model. J Biol Chem 279: 3852–3861, 2004. Katz EB, Stenbit AE, Hatton K, DePinho R, and Charron MJ. Cardiac and adipose tissue abnormalities but not diabetes in mice deficient in GLUT4. Nature 377: 151–155, 1995. Lim DS, Roberts R, and Marian AJ. Expression profiling of cardiac genes in human hypertrophic cardiomyopathy: insight into the pathogenesis of phenotypes. J Am Coll Cardiol 38: 1175–1180, 2001. Lin CS, Sun YL, and Liu CY. Structural and biochemical evidence of mitochondrial depletion in pigs with hypertrophic cardiomyopathy. Res Vet Sci 74: 219–226, 2003. Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, and Brown EL. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat Biotechnol 14: 1675–1680, 1996. Matsui H, Ihara Y, Fujio Y, Kunisada K, Akira S, Kishimoto T, and Yamauchi-Takihara K. Induction of interleukin (IL)-6 by hypoxia is mediated by nuclear factor (NF)-kappa B and NF-IL6 in cardiac myocytes. Cardiovasc Res 42: 104–112, 1999. Mervaala EM, Cheng ZJ, Tikkanen I, Lapatto R, Nurminen K, Vapaatalo H, Muller DN, Fiebeler A, Ganten U, Ganten D, and Luft FC. Endothelial dysfunction and xanthine oxidoreductase activity in rats with human renin and angiotensinogen genes. Hypertension 37: 414–418, 2001. Milani V, Noessner E, Ghose S, Kuppner M, Ahrens B, Scharner A, Gastpar R, and Issels RD. Heat shock protein 70: role in antigen presentation and immune stimulation. Int J Hyperthermia 18: 563–575, 2002. Mosser DD, Caron AW, Bourget L, Meriin AB, Sherman MY, Morimoto RI, and Massie B. The chaperone function of hsp70 is required for protection against stress-induced apoptosis. Mol Cell Biol 20: 7146–7159, 2000. Muller DN, Heissmeyer V, Dechend R, Hampich F, Park JK, Fiebeler A, Shagdarsuren E, Theuer J, Elger M, Pilz B, Breu V, Schroer K, Ganten D, Dietz R, Haller H, Scheidereit C, and Luft FC. Aspirin inhibits NF-kappaB and protects from angiotensin II-induced organ damage. FASEB J 15: 1822–1824, 2001. Muller DN, Shagdarsuren E, Park JK, Dechend R, Mervaala E, Hampich F, Fiebeler A, Ju X, Finckenberg P, Theuer J, Viedt C, Kreuzer J, Heidecke H, Haller H, Zenke M, and Luft FC. Immunosuppressive treatment protects against angiotensin II-induced renal damage. Am J Pathol 161: 1679–1693, 2002. Paternostro G, Clarke K, Heath J, Seymour AM, and Radda GK. Decreased GLUT-4 mRNA content and insulin-sensitive deoxyglucose uptake show insulin resistance in the hypertensive rat heart. Cardiovasc Res 30: 205–211, 1995. Razeghi P, Young ME, Alcorn JL, Moravec CS, Frazier OH, and Taegtmeyer H. Metabolic gene expression in fetal and failing human heart. Circulation 104: 2923–2931, 2001. Ruppert V, Nolte D, Aschenbrenner T, Pankuweit S, Funck R, and Maisch B. Novel point mutations in the mitochondrial DNA detected in patients with dilated cardiomyopathy by screening the whole mitochondrial genome. Biochem Biophys Res Commun 318: 535–543, 2004. Saavedra WF, Paolocci N, St John ME, Skaf MW, Stewart GC, Xie JS, Harrison RW, Zeichner J, Mudrick D, Marban E, Kass DA, and Hare JM. Imbalance between xanthine oxidase and nitric oxide synthase signaling pathways underlies mechanoenergetic uncoupling in the failing heart. Circ Res 90: 297–304, 2002. Sack MN and Kelly DP. The energy substrate switch during development of heart failure: gene regulatory mechanisms (Review). Int J Mol Med 1: 17–24, 1998. Schieffer B, Schieffer E, Hilfiker-Kleiner D, Hilfiker A, Kovanen PT, Kaartinen M, Nussberger J, Harringer W, and Drexler H. Expression of angiotensin II and interleukin 6 in human coronary atherosclerotic plaques: potential implications for inflammation and plaque instability. Circulation 101: 1372–1378, 2000.

CARDIAC GENE EXPRESSION IN DTGR

Physiol Genomics • VOL

18 •

43. Taegtmeyer H. Genetics of energetics: transcriptional responses in cardiac metabolism. Ann Biomed Eng 28: 871–876, 2000. 44. Taegtmeyer H and Dietze GJ. Perspective: from increased energy metabolism to cardiac hypertrophy and failure: mediators and molecular mechanisms. Am J Cardiol 83: 1H–2H, 1999. 45. Tanaka T, Kanda T, Takahashi T, Saegusa S, Moriya J, and Kurabayashi M. Interleukin-6-induced reciprocal expression of SERCA and natriuretic peptides mRNA in cultured rat ventricular myocytes. J Int Med Res 32: 57–61, 2004. 46. van Bilsen M, Smeets PJ, Gilde AJ, and van der Vusse GJ. Metabolic remodelling of the failing heart: the cardiac burn-out syndrome? Cardiovasc Res 61: 218–226, 2004. 47. Ventura-Clapier R, Garnier A, and Veksler V. Energy metabolism in heart failure. J Physiol 555: 1–13, 2004. 48. Viedt C, Vogel J, Athanasiou T, Shen W, Orth SR, Kubler W, and Kreuzer J. Monocyte chemoattractant protein-1 induces proliferation and interleukin-6 production in human smooth muscle cells by differential activation of nuclear factor-kappaB and activator protein-1. Arterioscler Thromb Vasc Biol 22: 914–920, 2002. 49. Wollert KC and Drexler H. The role of interleukin-6 in the failing heart. Heart Fail Rev 6: 95–103, 2001.

www.physiolgenomics.org

Downloaded from http://physiolgenomics.physiology.org/ at Penn State Univ on February 23, 2013

37. Sharma R, Bolger AP, Li W, Davlouros PA, Volk HD, Poole-Wilson PA, Coats AJ, Gatzoulis MA, and Anker SD. Elevated circulating levels of inflammatory cytokines and bacterial endotoxin in adults with congenital heart disease. Am J Cardiol 92: 188–193, 2003. 38. Srere P. Complexities of metabolic regulation. Trends Biochem Sci 19: 519–520, 1994. 39. Stangl V, Lorenz M, Meiners S, Ludwig A, Bartsch C, Moobed M, Vietzke A, Kinkel HT, Baumann G, and Stangl K. Long-term upregulation of eNOS and improvement of endothelial function by inhibition of the ubiquitin-proteasome pathway. FASEB J 18: 272–279, 2004. 40. Stanley WC and Chandler MP. Energy metabolism in the normal and failing heart: potential for therapeutic interventions. Heart Fail Rev 7: 115–130, 2002. 41. Stanley WC, Lopaschuk GD, Hall JL, and McCormack JG. Regulation of myocardial carbohydrate metabolism under normal and ischaemic conditions. Potential for pharmacological interventions. Cardiovasc Res 33: 243–257, 1997. 42. Suarez J, Belke DD, Gloss B, Dieterle T, McDonough PM, Kim YK, Brunton LL, and Dillmann WH. In vivo adenoviral transfer of sorcin reverses cardiac contractile abnormalities of diabetic cardiomyopathy. Am J Physiol Heart Circ Physiol 286: H68–H75, 2004.

267